Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.
نویسندگان
چکیده
The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.
منابع مشابه
Sequence-specific cleavage of double helical DNA by triple helix formation.
Homopyrimidine oligodeoxyribonucleotides with EDTA-Fe attached at a single position bind the corresponding homopyrimidine-homopurine tracts within large double-stranded DNA by triple helix formation and cleave at that site. Oligonucleotides with EDTA.Fe at the 5' end cause a sequence specific double strand break. The location and asymmetry of the cleavage pattern reveal that the homopyrimidine-...
متن کاملSequence-specific covalent labelling of DNA.
Sequence-specific DNA modification is of significance for applications in bio- and nano-technology, medical diagnostics and fundamental life sciences research. Preferentially, labelling should be performed covalently, which avoids doubts about label dissociation from the DNA under various conditions. Several methods to label native DNA have been developed in the last two decades. Triple-helix-f...
متن کاملPotassium-resistant triple helix formation and improved intracellular gene targeting by oligodeoxyribonucleotides containing 7-deazaxanthine.
Triple helix formation by purine-rich oligonucleotides in the anti-parallel motif is inhibited by physiological concentrations of potassium. Substitution with 7-deazaxanthine (c7X) has been suggested as a strategy to overcome this effect. We have tested this by examining triple helix formation both in vitro and in vivo by a series of triple helix-forming oligonucleotides (TFOs) containing guani...
متن کاملSequence-specific recognition and cleavage of duplex DNA via triple-helix formation by oligonucleotides covalently linked to a phenanthroline-copper chelate.
Homopyrimidine oligodeoxynucleotides recognize the major groove of the DNA double helix at homopurine.homopyrimidine sequences by forming local triple helices. Phenanthroline was covalently attached to the 5' end of an 11-mer homopyrimidine oligonucleotide of sequence d(TTTCCTCCTCT). Simian virus 40 DNA, which contains a single target site for this oligonucleotide, was used as a substrate for t...
متن کاملA MODEL FOR THE BASIC HELIX- LOOPHELIX MOTIF AND ITS SEQUENCE SPECIFIC RECOGNITION OF DNA
A three dimensional model of the basic Helix-Loop-Helix motif and its sequence specific recognition of DNA is described. The basic-helix I is modeled as a continuous ?-helix because no ?-helix breaking residue is found between the basic region and the first helix. When the basic region of the two peptide monomers are aligned in the successive major groove of the cognate DNA, the hydrophobi...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Nucleic acids research
دوره 26 4 شماره
صفحات -
تاریخ انتشار 1998